rs842075 chr2:158967415 A>G
- Sequence
cacccctcctgctggtgtctttat[A/G]tagggaagctctgcgtgaggttga
- ASB in cell types
- HEK293T (embryonic kidney) HEK293 (embryonic kidney) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 1.05 | -0.06 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.38 | 0.52 | 1.30 | |||
| SK-N-SH (neuroblastoma) | -1.72 | 1.65 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid