rs842192 chr1:177946339 A>C
- Sequence
gaaattcacatgagaaaatgaaaa[A/C]tggatccataaaacccaacaaggg
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.25 | 0.56 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, obesity with early age of onset (age >2), salmonella-induced pyroptosis, tardive dyskinesia