rs842444 chr7:158779182 A>G
- Sequence
ctatcaaaacaaaagatcaaaggc[A/G]tcaaacataggaagaagtttctat
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.51 | 0.18 | 1.51 | |||
| HEK293 (embryonic kidney) | -0.45 | 0.75 | 1.94 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, homa-ir, ldl cholesterol, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood