rs844484 chr2:128306301 C>T
- Sequence
tgtggtcgggctggaggacgtggc[C/T]gcgccgctgcgaagatttctctgc
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (pleiomorphic breast carcinoma) | 1.77 | n/a | 1.33 | |||
| K562 (myelogenous leukemia) | 0.73 | -0.23 | 1.98 |
Items per page:
1 – 2 of 2