rs844649 chr1:173255204 T>C
- Sequence
aagaatgtgtgtacaattacagca[T/C]gtgtctttgtgccttttttaggct
- ASB in cell types
- foreskin keratinocyte PC3 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.21 | 2.39 | 2.00 | |||
| PC3 (prostate carcinoma) | 1.85 | -2.99 | 2.17 |
Items per page:
1 – 2 of 2