rs846193 chr20:60589896 A>G
- Sequence
acaaaacacatttccgtattatat[A/G]cattttgcatattaaagagagaaa
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- REST_HUMAN EHMT2_HUMAN NCOA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.07 | 1.63 | 1.73 | n/a | No Hit | |||
| EHMT2_HUMAN | 2.55 | n/a | 2.00 | n/a | n/a | |||
| NCOA1_HUMAN | 2.00 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), mitral annular calcium, pulse rate, tetrology of fallot