rs846870 chr19:44583087 C>T
- Sequence
ccccctgttggtcactcatggcaa[C/T]ggccccattggtgtcccaggacaa
- ASB in cell types
- MCF10A (breast epithelial cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | n/a | 2.42 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.67 | 0.05 | 1.83 |
Items per page:
1 – 2 of 2