rs846885 chr19:44607097 G>T
- Sequence
tccctcacacagggcaggagaaat[G/T]atgactgatggtacagggactcaa
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma) monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.88 | n/a | 2.50 | n/a | No Hit | |||
| ERR1_HUMAN | -2.51 | 1.70 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), rheumatoid arthritis, type 1 diabetes, combined control dataset, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid