rs847276 chr14:72237797 C>T
- Sequence
ggggaatgtggcaagaatgaaccc[C/T]gtactggtactggtcaacggcagc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.05 | 0.72 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, mitral annular calcium, parkinsons disease, waist hip ratio