rs847405 chr7:16926556 G>T
- Sequence
gttctgctttactgaacagaaagc[G/T]gttccattccaaatttgatcctaa
- ASB in cell types
- A549 (lung carcinoma) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.56 | -0.14 | 2.00 | |||
| prostate gland | -1.30 | 1.60 | 1.00 |
Items per page:
1 – 2 of 2