rs849162 chr7:43782253 A>G
- Sequence
gggagggtcagtgaaagtgtagag[A/G]aaggaaatcatatgacagaaattt
- ASB in cell types
- SK-N-SH (neuroblastoma) HEK293 (embryonic kidney) macrophages monocyte-derived macrophages
- ASB for transcription factors
- TF65_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | n/a | 2.51 | 2.50 | n/a | No Hit | |||
| CEBPB_HUMAN | -0.52 | 1.84 | 1.92 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood