rs849706 chr1:16610148 G>T
- Sequence
tagaatactattgtttatatcaca[G/T]cacgtgagccccttaaatggctta
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.96 | -0.29 | 1.99 | |||
| K562 (myelogenous leukemia) | -0.00 | 0.91 | 2.45 |
Items per page:
1 – 2 of 2