rs856560 chr7:46687365 T>C
- Sequence
aaaagaaaatgtggtatatacaga[T/C]gatgcaatagtattcagccttaaa
- ASB in cell types
- LHSAR (prostate epithelial cells) mesenchymal stem cells
- ASB for transcription factors
- ANDR_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.40 | -0.61 | 2.25 | n/a | No Hit | |||
| CEBPB_HUMAN | 1.89 | -0.26 | 1.33 | -6.36 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP serum creatinine, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (males), suicide attempts in bipolar disorder (substance abuse/dependence), urinary albumin-to-creatinine ratio