rs860757 chr3:189961584 G>A
- Sequence
tgctgctgcacgttagaatcacct[G/A]gggagctcttaaaactcctgaaac
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.35 | 2.15 | 1.33 | |||
| foreskin keratinocyte | 0.42 | n/a | 2.17 |
Items per page:
1 – 2 of 2