rs863750 chr12:124020897 C>T
- Sequence
ggctttttaccaaaaaaatttccc[C/T]atctctggtctaagtcacttgtac
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (pleiomorphic breast carcinoma) | 1.69 | -1.72 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI high density lipoprotein cholesterol levels, red cell distribution width, triglycerides, waist-hip ratio, waist-to-hip ratio adjusted for bmi (adjusted for smoking behaviour), waist-to-hip ratio adjusted for body mass index
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), fasting insulin, hdl cholesterol, longstanding arthritis, neuroblastoma (brain cancer), systolic blood pressure (sbp), triglycerides, type 2 diabetes, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach