rs8669 chr17:75754778 C>G
- Sequence
acactcacactcgaccacactgcc[C/G]agggactactccaccctcacctcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.77 | 0.03 | 1.62 | |||
| HEK293 (embryonic kidney) | 0.72 | 0.57 | 1.68 |
Items per page:
1 – 2 of 2