rs867311 chr2:111920393 G>T
- Sequence
gcactgactcagagccagccaccc[G/T]ctttctcttgcagggctttgctac
- ASB in cell types
- HepG2 (hepatoblastoma) monocyte-derived macrophages periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.13 | -0.23 | 1.98 | |||
| monocyte-derived macrophages | 1.59 | -3.95 | 2.50 | |||
| periferal blood macrophages | 1.03 | 2.11 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Stomach, Testis, Thyroid, Whole_Blood