rs867538 chr1:18406486 T>C
- Sequence
tctacccagaacctgaggaactat[T/C]tattcaacaaacccccatttgctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.68 | 1.83 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease