rs870685 chr8:133001497 C>A
- Sequence
ttttcattctgcaaataaccacaa[C/A]attacaaggatgtctttatttggt
- ASB in cell types
- CWR22 (prostate carcinoma) embryonic kidney
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | 1.14 | -0.60 | 1.50 | |||
| embryonic kidney | 1.49 | -1.29 | 2.00 |
Items per page:
1 – 2 of 2