rs873985 chr3:50614320 A>G
- Sequence
aatttccatagattcttctcttct[A/G]ggataatccctctcctgcacccca
- ASB in cell types
- epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.07 | -1.47 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), diastolic blood pressure (clinic), diastolic blood pressure (dbp), diastolic blood pressure (mean 24-hour excluding subjects on antihypertensive treatment), diastolic blood pressure (mean 24-hour), systolic blood pressure (sbp), systolic blood pressure (sbp), 24 hour mean, systolic blood pressure (sbp), clinic measurements, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood