rs8756 chr12:65965972 C>A
- Sequence
ctttgctgttgttggtcgcagcta[C/A]ataagactggacatttaacttttc
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.28 | 1.57 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), college completion, coronary artery disease (cad), estimated total intracranial volume (excluding patients with neuropsychiatric disorders), eye color, femur length, height, height (adults), height (females), height (males), hip axis length, hip bone mineral density (bmd), infant head circumference, intracranial volume, newborn birth weight (gm), obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, spine bone mineral density (bmd), years of education
PheWAS abdominal hernia, abnormal findings examination of lungs, aphakia and other disorders of lens, aphasia/speech disturbance, atherosclerosis of renal artery, atopic or contact dermatitis, atrial fibrillation, atrial fibrillation & flutter, atrophy of edentulous alveolar ridge, benign neoplasm of other endocrine glands, benign neoplasm of other parts of digestive system, bipolar, bundle branch block, cardiac conduction disorders, cardiac dysrhythmias, carditis, cervicocranial/cervicobrachial syndrome, chronic liver disease and cirrhosis, conductive hearing loss, congenital anomalies of face and neck, congenital cataract and lens anomalies, corneal opacity, dermatosis nos, diabetes mellitus, diaphragmatic hernia, diseases of the tongue, disorders of the globe, disorders of the pituitary gland and its hypothalamic control, endocarditis, erectile dysfunction, fracture of vertebral column without mention of spinal cord injury, hallux rigidus, heart failure nos, hematuria, hemorrhage or hematoma complicating a procedure, hydrocele, hypertensive chronic kidney disease, impaction of intestine, infection/inflammation of internal prosthetic device, implant or graft, localized superficial swelling, mass, or lump, loose body in joint, lymphadenitis, major depressive disorder, male genital disorders, mental retardation, obstruction of bile duct, osteoarthritis, localized, other cerebral degenerations, other diseases of the teeth and supporting structures, other disorders of eye, other specified cardiac dysrhythmias, pallor and flushing, pituitary hypofunction, pleurisy, pleural effusion, pneumonia, poisoning by psychotropic agents, polyneuropathy in diabetes, posttraumatic stress disorder, posttraumatic wound infection, rash and other nonspecific skin eruption, retinal drusen, right bundle branch block, skin neoplasm of uncertain behavior, spondylosis with myelopathy, suicidal ideation or attempt, swelling, mass, or lump in head and neck, synoviopathy, tachycardia nos, type 2 diabetes, type 2 diabetic ketoacidosis, type 2 diabetic neuropathy, urinary tract infection, uterine cancer, varicose veins of lower extremity, symptomtic, viral enteritis