rs875602 chr22:23053506 T>C
- Sequence
tcacaatgcacactgctgggagcc[T/C]gatctgaatgaacacagggtcgtc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -1.26 | 0.87 | 5.81 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, body mass index (bmi), obesity (body mass index (bmi)), obesity with early age of onset (age >2), postoperative nausea and vomiting, spine bone mineral density (bmd)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Thyroid, Whole_Blood