rs875898 chr7:27161286 A>G
- Sequence
gagtctgcgtggagcccggaatct[A/G]ctgcagaggaggcaatgccaataa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.04 | 0.65 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.42 | 0.61 | 1.51 | |||
| foreskin keratinocyte | n/a | 0.70 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP asthma, body mass index (bmi), coronary artery disease (cad), fasting insulin, homa-ir, pulse rate, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Vagina, Whole_Blood