rs879142 chr19:17511582 A>G
- Sequence
gtgccaaagacaatcacccaaagt[A/G]ctcgaaaccaagcggcagggccgg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells) foreskin keratinocyte
- ASB for transcription factors
- NRF1_HUMAN ZN143_HUMAN CTCF_HUMAN ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 0.15 | 1.37 | 1.98 | n/a | No Hit | |||
| ZN143_HUMAN | -2.01 | 1.81 | 1.50 | 1.78 | Weak Concordant | |||
| CTCF_HUMAN | 0.54 | 0.68 | 1.24 | n/a | No Hit | |||
| ZNF24_HUMAN | 0.03 | 1.55 | 2.10 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid