rs892015 chr19:39194269 A>C
- Sequence
tagagatacaattaccagttccca[A/C]ctctgcagggttgtgaggttcaaa
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.73 | 1.27 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-hepatitis c virus treatment response (sustained virological response), late onset alzheimers disease, simpson-angus scale, triglycerides, triglycerides change with statins
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Pancreas, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid