rs897951 chr15:95024442 G>A
- Sequence
cttctgagctgtaaaattacagct[G/A]cgtttgtccttggatgaggttggg
- ASB in cell types
- LNCaP (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.58 | -1.49 | 1.00 | |||
| A549 (lung carcinoma) | -1.49 | 1.57 | 1.33 |
Items per page:
1 – 2 of 2