rs919690 chr2:43657443 C>G
- Sequence
ctcccaaggtagccagatctctgt[C/G]catggtgattcagggctccaagaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.98 | -2.01 | 1.33 | -3.96 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Colon_Sigmoid, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid