rs921068 chr2:42979841 A>G
- Sequence
ttatctggtctagagggttaatca[A/G]tgaccacttggaggtgggggaagc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN P66A_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 0.67 | 0.01 | 1.71 | n/a | No Hit | |||
| P66A_HUMAN | 2.87 | n/a | 2.00 | n/a | n/a | |||
| FOXA1_HUMAN | 1.00 | 0.28 | 1.66 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), diastolic blood pressure (dbp), fasting blood glucose, ldl cholesterol change with statins, neuroblastoma (brain cancer), systolic blood pressure (sbp), total cholesterol, triglycerides