rs9225 chr2:46858973 C>T
- Sequence
gtgaacctaggaaaaatatcatct[C/T]tgtagggcaataaaccatgtgatt
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.34 | -2.93 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease, hdl cholesterol, homa-ir, multiple sclerosis (females), paternal transmission distortion, premature ovarian failure, prop taste detection threshold, rheumatoid arthritis, transmission distortion, triglycerides