rs9257172 chr6:28776528 G>A
- Sequence
gattaagggagagtctaaaaacaa[G/A]gttaggtactacaaagtcgcggta
- ASB in cell types
- K562 (myelogenous leukemia) HUES64 (embryonic stem cells)
- ASB for transcription factors
- OTX2_HUMAN PRD10_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.77 | n/a | 1.33 | n/a | No Hit | |||
| PRD10_HUMAN | n/a | 2.78 | 3.00 | n/a | n/a | |||
| LMBL2_HUMAN | n/a | 2.09 | 3.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood