rs9267084 chr6:31441828 G>A
- Sequence
cgtgtggccacaggactgaagaca[G/A]aggaccccgctcccctttctcccc
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma) NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.70 | n/a | 2.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.45 | 0.81 | 1.42 | |||
| NB69 (neuroblastoma) | -1.47 | 1.28 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood