rs9272484 chr6:32638166 G>A
- Sequence
agtaatcaaataaaatgggcatgt[G/A]gctaagctttgtaaatagtgaaaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.79 | -0.47 | 2.42 |
Items per page:
1 – 1 of 1