rs9276935 chr6:32968664 T>C
- Sequence
agtgggggggacagagtccaggac[T/C]gcgggataggaagctggggatatg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.57 | n/a | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), joint damage severity in rheumatoid arthritis, ldl cholesterol, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Thyroid