rs927731 chr13:29924348 A>G
- Sequence
ttggcagcctttgtctccgggggc[A/G]cgtgcaatacagcgccccctgctg
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 1.19 | 0.04 | 1.33 | -5.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP mitral annular calcium, obesity with early age of onset (age >2), systolic blood pressure (sbp)