rs9287698 chr2:8347166 C>T
- Sequence
aagcatgatatccactttgtaagt[C/T]cttcctaattggctatccacattc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | 1.09 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), cognitive response of healthy volunteers to topiramate treatment as measure by the trailsa cognitive test, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, primary rhegmatogenous retinal detachment, total cholesterol, triglycerides