rs9304191 chr18:38449401 A>C
- Sequence
gcgaaacgattgaatgttgaagga[A/C]gcatcagtaaaacaagaatcctag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | n/a | 1.35 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), chronic kidney disease, diastolic blood pressure (dbp), infant head circumference, ldl cholesterol, spine bone mineral density (bmd)