rs9306472 chr22:44027032 T>C
- Sequence
agtgtctgagaatgagcttcacgg[T/C]gggcgtgattaaggctgatgtgct
- ASB in cell types
- upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 2.10 | -1.93 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Stomach, Thyroid