rs9311833 chr3:62007992 A>G
- Sequence
agtgtccttaaagtaaacaaactc[A/G]gaatattccagtcattaaaacagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) VCaP (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.08 | -1.47 | 4.90 | n/a | No Hit | |||
| PRGR_HUMAN | 1.91 | n/a | 2.25 | -2.89 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP bipolar disorder, height, hypertriglyceridemia, schizophrenia, simpson-angus scale, triglycerides change with statins