rs931587 chr12:54680521 G>A
- Sequence
ggctagcagggtagcatgatcttg[G/A]caggaatggaggaatccgaggtgt
- ASB in cell types
- HEK293 (embryonic kidney) upper lobe of left lung H54 esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.74 | -0.12 | 1.99 | |||
| upper lobe of left lung | 0.47 | 1.90 | 1.11 | |||
| H54 | -1.67 | 2.03 | 2.00 | |||
| esophagus squamous epithelium | -0.00 | 1.30 | 1.00 |
Items per page:
1 – 4 of 4