rs9320406 chr6:112312343 G>T
- Sequence
ttctgccctttttgaactatatca[G/T]agcattgaaaaatctggcggtttc
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.02 | 2.17 | 2.50 | |||
| PC9 (lung adenocarcinoma) | n/a | 2.13 | 4.00 |
Items per page:
1 – 2 of 2