rs9321715 chr6:139369934 A>G
- Sequence
taactgttcttcaaagacccatcc[A/G]tagctctaacgtctttatcagctc
- ASB in cell types
- K562 (myelogenous leukemia) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.44 | 0.53 | 1.33 | |||
| VCaP (prostate carcinoma) | 1.57 | -0.44 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hdl cholesterol change with statins, infant head circumference, triglycerides change with statins