rs9327800 chr5:137743498 G>A
- Sequence
tacataaaaaggtaaaatataaat[G/A]aatgatgcaaagccctaaagtcaa
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.74 | 1.01 | 1.76 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), cystatin c in serum, irritible bowel syndrome, rheumatoid arthritis, tardive dyskinesia, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis