rs9355574 chr6:166361201 A>G
- Sequence
accgttgatttctccaccactccc[A/G]catgcgggccactctcactgcgca
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 1.52 | -1.18 | 1.00 | 2.33 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi)
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood