rs9358924 chr6:26322245 G>A
- Sequence
ttgcttcccgggtgctttgccacc[G/A]gtcgatttgccggtcgatttgcgg
- ASB in cell types
- HepG2 (hepatoblastoma) MCF10AT1 (breast premetastatic epithelial cells) erythroid cells 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.74 | -0.16 | 2.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -2.41 | 2.32 | 1.33 | |||
| erythroid cells | 2.18 | -1.75 | 2.00 | |||
| 786-O (renal carcinoma) | 2.21 | -1.79 | 2.00 | |||
| CD14+ monocytes | 1.63 | n/a | 2.50 |
Items per page:
1 – 5 of 5