rs9358925 chr6:26322540 C>G
- Sequence
tttttagtagagacgggggtttct[C/G]tgttttggccagactggtctcgaa
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.36 | -0.66 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, diastolic blood pressure (dbp), hdl cholesterol, height, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), obesity with early age of onset (age >2), rheumatoid arthritis, systolic blood pressure (sbp)