rs9368699 chr6:31834764 T>C
- Sequence
cccagaggagtgtgaaacatactt[T/C]cctggtctttctttcactttgttt
- ASB in cell types
- spleen
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | -1.75 | 1.68 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol, hiv-1 control, hiv-1 control (viral load at set point), hiv-1 control (viral load), hiv-1 disease progression, hiv-1 infection (natural long-term nonprogression), hiv-1 seropositive nonprogression, hiv-1 seropositive nonprogression (male vs. female), hiv-1 seropositive nonprogression (males), irritible bowel syndrome, ldl cholesterol, psoriasis and/or psoriatic arthritis, psoriasis only (no arthritis), psoriatic arthritis, rheumatoid arthritis, total cholesterol, type 1 diabetes, urinary albumin-to-creatinine ratio, years of education
PheWAS abdominal hernia, abnormal findings on radiological breast exam, acquired spondylolisthesis, acute laryngitis and tracheitis, acute sinusitis, acute upper respiratory infections, acute, but ill-defined cerebrovascular disease, anomalies of pupillary function, aphasia/speech disturbance, bacterial enteritis, bacterial infection nos, benign mammary dysplasias, cancer of bone & connective tissue, carbuncle and furuncle, cardiac and circulatory congenital anomalies, cardiac congenital anomalies, cellulitis and abscess of face, cerebrovascular disease, chronic hepatitis, chronic laryngitis, chronic ulcer of leg or foot, congenital anomalies of genital organs, corneal dystrophy, cystic mastopathy, delirium dementia and amnestic disorders, dementias, diabetic retinopathy, diseases of the larynx and vocal cords, disorders of cornea, disorders of fluid, electrolyte, and acid-base balance, dyschromia and vitiligo, edema, electrolyte imbalance, epilepsy, recurrent seizures, convulsions, fracture of hand or wrist, fuchs dystrophy, genital prolapse, gram negative septicemia, hereditary and idiopathic peripheral neuropathy, hydronephrosis, hyposmolality and/or hyponatremia, infertility, male, iron deficiency anemia secondary to blood loss, jaw disease nos, keratoconjunctivitis sicca, keratoconjunctivitis, noninfectious, macular degeneration, macular degeneration, wet, magnesium metabolism disorder, male genital disorders, male infertility and abnormal spermatozoa, memory loss, mitral valve stenosis and/or aortic valve stenosis, neck pain, neurological disorders due to brain damage, nonspecific findings on examination of blood, occlusion and stenosis of precerebral arteries, other acquired musculoskeletal deformity, other hypertrophic and atrophic conditions of skin, other infectious diseases, other specified diseases of sebaceous glands, other specified nonpsychotic and/or transient mental disorders, other specified osteoporosis, paralytic ileus, persistent mental disorders due to other conditions, personal history of allergy to medicinal agents, poisoning by analgesics, antipyretics, and antirheumatics, prolapse of vaginal walls, pseudoexfoliation glaucoma, psoriasis, psoriasis & related disorders, psoriasis vulgaris, psoriatic arthropathy, respiratory failure, respiratory failure, insufficiency, arrest, retinal disorders, rosacea, sialoadenitis, spermatocele, stricture/obstruction of ureter, substance addiction and disorders, torticollis, type 2 diabetic ketoacidosis, unspecified local infection of skin and subcutaneous tissue, uterine/uterovaginal prolapse, vascular disorders of penis, ventral hernia, viral warts & hpv, vitamin b-complex deficiencies, voice disturbance
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood