rs9377136 chr6:148451862 G>A
- Sequence
ctggtgctgacatgaatgcatcct[G/A]tctccacatcctgtttgtggcggg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia) liver
- ASB for transcription factors
- COT2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT2_HUMAN | 1.26 | -1.43 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, sporadic creutzfeldt-jakob disease, total cholesterol change with statins