rs9379750 chr6:25265919 A>G
- Sequence
tggcattttagattgggaatgtgt[A/G]gaagcaccacaacctatcatcaga
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.36 | 0.52 | 1.27 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), refractive error, salmonella-induced pyroptosis, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid