rs9389933 chr6:141562844 G>A
- Sequence
agatttgtctctttgcctttaaaa[G/A]ttaaatccaccttcatcgcacaat
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) B-cells H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.52 | 0.29 | 1.40 | |||
| GM12878 (female B-cells) | -0.62 | 1.29 | 1.42 | |||
| B-cells | 2.00 | n/a | 2.00 | |||
| H929 (plasma cell myeloma) | 1.81 | -2.11 | 1.50 |
Items per page:
1 – 4 of 4