rs9405302 chr6:6477616 G>A
- Sequence
ggacacaggggtcacaatttggac[G/A]agtcagattgccttagcacggcca
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 2.22 | -1.89 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cisplatin cytotoxicity in lung cancer patients treated with platinum-based chemotherapy as measured by cisplatin ic50 in lymphoblastoid cell lines, diabetic retinopathy in type 2 diabetes mellitus, infant head circumference, mitral annular calcium, overall survival of lung cancer patients treated with platinum compounds (among non-small cell lung cancer patients)